Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110F21

Clone ID RBdS110F21
HP ID HP09162
Gene ID 55255
Gene Symbol WDR41
Protein Name WD repeat domain 41
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018268.2
Length of RefSeq (bp) 2608
Chromosome 5q14.1
Reference DDBJ accession
UniGene Hs.482573
5'-terminal sequence GACTCGGAGCAGCGCGCGCCCCGCAATCGCCGCAGCCGCCCCCGCCGTCGGCCGCCGCAC
2011.08.28