Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09141

HP ID(1) HP09141
Gene ID(2) 5049
Gene Symbol finder PAFAH1B2
Protein Name platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa
RefSeq NM_002572.2
Length of RefSeq (bp) 1191
Chromosome 11q23
Reference DDBJ accession
UniGene Hs.597488

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105K19 pGCAP10 CGGCCGGCCGATGGCTGCTGCTGGTGCTGGGGCCGGAGGAGGGACGCGCCGGAGCGGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl