Prev. |  KEGG KO K16795 > 

RIKEN DNA Bank Human Resource - PAFAH1B2

Gene ID NCBI Gene 5049 |  KEGG hsa:5049
Gene Symbol PAFAH1B2
Protein Name platelet activating factor acetylhydrolase 1b catalytic subunit 2
Synonyms HEL-S-303
Ortholog resource in our bank

  PAFAH1B2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080598 IRAL001I06 pOTB7 BC000398 NM_002572 Full
HGY082779 IRAL006P19 pOTB7 BC001774 NM_002572 Partial
HGY083977 IRAL009P17 pOTB7 BC019301 NM_002572 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442259 RBdS105K19 pGCAP10 NM_002572.2  
CGGCCGGCCGATGGCTGCTGCTGGTGCTGGGGCCGGAGGAGGGACGCGCCGGAGCGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl