Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09136

HP ID(1) HP09136
Gene ID(2) 56967
Gene Symbol finder C14orf132
Protein Name chromosome 14 open reading frame 132
RefSeq NR_023938.1
Length of RefSeq (bp) 7504
Chromosome 14q32.2
Reference DDBJ accession
UniGene Hs.6434

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105G10 pGCAP10 AGAAGCCCAGAGACAGCCGAGTGCGCCGTGCGGTCTCCGGACGCTCGCTGCTCAGCCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl