Prev. |  Human A to Z list >  C >  C14orf132 > 

NRCD Human cDNA Clone - RBdS105G10

Catalog Number HKR442154
Clone Name RBdS105G10
Clone info. Plasmid clone of human C14orf132 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) AGAAGCCCAGAGACAGCCGAGTGCGCCGTGCGGTCTCCGGACGCTCGCTGCTCAGCCCGA
Sequence, submitted(2) AB621830 link 01
 
Sequence, refered NR_023938.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) C14orf132 (NCBI Gene 56967) finder other clones with this gene.
Synonyms C14orf88
Protein Name chromosome 14 open reading frame 132
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR442154 RBdS105G10 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl