RBdS105G10 NRCD Human cDNA Clone

Prev. | Human A to Z list > C > C14orf132 >

RBdS105G10 - NRCD Human cDNA Clone


Catalog Number	HKR442154
Clone Name	RBdS105G10
Clone info.	Plasmid clone of human C14orf132 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	AGAAGCCCAGAGACAGCCGAGTGCGCCGTGCGGTCTCCGGACGCTCGCTGCTCAGCCCGA
Sequence, submitted⁽³⁾	AB621830 [link]
Sequence, refered	NR_023938.1 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	C14orf132 (NCBI Gene 56967) other clone of C14orf132 in our bank
Synonyms	C14orf88
Protein Name	chromosome 14 open reading frame 132

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR442154	RBdS105G10	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS105G10 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR442154).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.