Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09129

HP ID(1) HP09129
Gene ID(2) 5147
Gene Symbol finder PDE6D
Protein Name phosphodiesterase 6D, cGMP-specific, rod, delta
RefSeq NM_002601.2
Length of RefSeq (bp) 1140
Chromosome 2q35-q36
Reference DDBJ accession
UniGene Hs.516808

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS105C12 pGCAP10 TGAGAAGCGGGAGCTGAGGGGAGAGAGAGGCCGGTCCTGGTCTGGCCGCTGCGGCTGCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl