Prev. |  KEGG KO K13758 > 

RIKEN DNA Bank Human Resource - PDE6D

Gene ID NCBI Gene 5147 |  KEGG hsa:5147
Gene Symbol PDE6D
Protein Name phosphodiesterase 6D
Synonyms JBTS22|PDED
Ortholog resources KEGG ortholog (KEGG orthology K13758) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088020 IRAL020A20 pOTB7 BC007831 NM_002601 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113626 M01C084B02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113674 M01C084D02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113722 M01C084F02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113770 M01C084H02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113818 M01C084J02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113866 M01C084L02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113914 M01C084N02 pDONR221 IMS05-H01 BC007831 NM_002601  
HGE113962 M01C084P02 pDONR221 IMS05-H01 BC007831 NM_002601  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR442060 RBdS105C12 pGCAP10 NM_002601.2  
TGAGAAGCGGGAGCTGAGGGGAGAGAGAGGCCGGTCCTGGTCTGGCCGCTGCGGCTGCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl