Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09106

HP ID(1) HP09106
Gene ID(2) 347741
Gene Symbol finder OTOP3
Protein Name otopetrin 3
RefSeq NM_178233.1
Length of RefSeq (bp) 1791
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.454407

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS104E07 pGCAP10 GGATCCGCTCAGCGCCCGCAGTCGGTGGTTAGCCCACGGCGATGCCTCTCCCGGCCTCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl