Prev. | 

RIKEN DNA Bank Human Resource - OTOP3

Gene ID NCBI Gene 347741 |  KEGG hsa:347741
Gene Symbol OTOP3
Protein Name otopetrin 3
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR441703 RBdS104E07 pGCAP10 NM_178233.1  
GGATCCGCTCAGCGCCCGCAGTCGGTGGTTAGCCCACGGCGATGCCTCTCCCGGCCTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl