Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09096

HP ID(1) HP09096
Gene ID(2) 152002
Gene Symbol finder C3orf21
Protein Name chromosome 3 open reading frame 21
RefSeq NM_152531.4
Length of RefSeq (bp) 2830
Chromosome 3q29
Reference DDBJ accession
UniGene Hs.478741

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083N08 pGCAP10 GGCGNCCCCGCCCCTTTCATGGCCGCCGCCTGGCGCCGGGGCTAAGTGGCCGCCGGCGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl