Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09093

HP ID(1) HP09093
Gene ID(2) 7349
Gene Symbol finder UCN
Protein Name urocortin
RefSeq NM_003353.2
Length of RefSeq (bp) 615
Chromosome 2p23-p21
Reference DDBJ accession
UniGene Hs.534363

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083K05 pGCAP10 ACTACTTTGGCAAACTCAAAAGCAGATGGGCCAGCCATTTGTGGTCTGAAAGCACTCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl