Prev. | 

RIKEN DNA Bank Human Resource - UCN

Gene ID NCBI Gene 7349 |  KEGG hsa:7349
Gene Symbol UCN
Protein Name urocortin
Synonyms UI|UROC
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR433445 RBdS083K05 pGCAP10 NM_003353.2  
ACTACTTTGGCAAACTCAAAAGCAGATGGGCCAGCCATTTGTGGTCTGAAAGCACTCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl