Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09092

HP ID(1) HP09092
Gene ID(2) 59338
Gene Symbol finder PLEKHA1
Protein Name pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
RefSeq NM_001001974.1
Length of RefSeq (bp) 3750
Chromosome 10q26.13
Reference DDBJ accession
UniGene Hs.643512

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083J23 pGCAP10 GGGCAGTGCGCGGGCTGGCCGTCGCGGACGCCGCTCCGGGCAGCCGAGCCTCTGTGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl