Prev. | 

RIKEN DNA Bank Human Resource - PLEKHA1

Gene ID NCBI Gene 59338 |  KEGG hsa:59338
Gene Symbol PLEKHA1
Protein Name pleckstrin homology domain containing A1
Synonyms TAPP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028863 IRAK072C15 pBluescriptR BC042458 NM_021622 Full
HGX032804 IRAK082A04 pCMV-SPORT6 BC041654 NM_021622
HGY081231 IRAL003B07 pOTB7 BC001136 NM_021622 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR433439 RBdS083J23 pGCAP10 NM_001001974.1  
GGGCAGTGCGCGGGCTGGCCGTCGCGGACGCCGCTCCGGGCAGCCGAGCCTCTGTGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl