Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09089

HP ID(1) HP09089
Gene ID(2) 56937
Gene Symbol finder PMEPA1
Protein Name prostate transmembrane protein, androgen induced 1
RefSeq NM_020182.3
Length of RefSeq (bp) 4930
Chromosome 20q13.31-q13.33
Reference DDBJ accession
UniGene Hs.517155

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083I17 pGCAP10 GAGACCGTCTGCCTGCCTCCGACCGCGGTCTCGGAGCGAAACCCGATCTCCTTGGACTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl