Prev. | 

RIKEN DNA Bank Human Resource - PMEPA1

Gene ID NCBI Gene 56937 |  KEGG hsa:56937
Gene Symbol PMEPA1
Protein Name prostate transmembrane protein, androgen induced 1
Synonyms STAG1|TMEPAI
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08016 pCMVhsTMEPAIa Expression vector of human TMEPAI isoform a cDNA
RDB08017 pCMVhsTMEPAIb Expression vector of human TMEPAI isoform b cDNA
RDB08018 pCMVhsTMEPAIc Expression vector of human TMEPAI isoform c cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091701 IRAL029E05 pOTB7 BC015918 NM_199171 Full
HGY097074 IRAL042L10 pOTB7 BC025361 NM_199171
HGY103906 IRAL059M18 pOTB7 BC080635 NM_199171 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE030584 W01A076H16 pENTR-TOPO IRAL029E05 BC015918 NM_199171  
HGE030588 W01A076H20 pENTR-TOPO IRAL029E05 BC015918 NM_199171  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR433409 RBdS083I17 pGCAP10 NM_020182.3  
GAGACCGTCTGCCTGCCTCCGACCGCGGTCTCGGAGCGAAACCCGATCTCCTTGGACTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl