Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09078

HP ID(1) HP09078
Gene ID(2) 1307
Gene Symbol finder COL16A1
Protein Name collagen, type XVI, alpha 1
RefSeq NM_001856.3
Length of RefSeq (bp) 5584
Chromosome 1p35-p34
Reference DDBJ accession
UniGene Hs.368921

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083E16 pGCAP10 GAGTTGGGTTTCTGGGTGTCGTGCGGCCCTGCCCCTCTGTGCCCGGCACCTTGGCCGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl