Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083E16

Clone ID RBdS083E16
HP ID HP09078
Gene ID 1307
Gene Symbol COL16A1
Protein Name collagen, type XVI, alpha 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001856.3
Length of RefSeq (bp) 5584
Chromosome 1p35-p34
Reference DDBJ accession
UniGene Hs.368921
5'-terminal sequence GAGTTGGGTTTCTGGGTGTCGTGCGGCCCTGCCCCTCTGTGCCCGGCACCTTGGCCGGCT
2011.08.28