Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09068

HP ID(1) HP09068
Gene ID(2) 9529
Gene Symbol finder BAG5
Protein Name BCL2-associated athanogene 5
RefSeq NM_001015048.1
Length of RefSeq (bp) 4840
Chromosome 14q32.33
Reference DDBJ accession
UniGene Hs.5443

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS081M09 pGCAP10 GGCGATGGCGCGgGCGGGACAGTGCTTGTGAAACTGAACACAACAAAAGTATGGATATGG
RBdS187M20 pGCAP10 GAGACTCTGTAGATACTGAAGGAAAAGGAGATATTCAGCAAGCTAGGAAGCGGGCAGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl