Prev. |  KEGG KO K09559 > 

RIKEN DNA Bank Human Resource - BAG5

Gene ID NCBI Gene 9529 |  KEGG hsa:9529
Gene Symbol BAG5
Protein Name BCL2 associated athanogene 5
Synonyms BAG-5
Ortholog resources KEGG ortholog (KEGG orthology K09559) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX042998 IRAK107I06 pCMV-SPORT6 BC050551 NM_004873 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094837 M01C037B13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE094885 M01C037D13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE094933 M01C037F13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE094981 M01C037H13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE095029 M01C037J13 pDONR221 MGC08-C07 BC044216 NM_004873 done
HGE095077 M01C037L13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE095125 M01C037N13 pDONR221 MGC08-C07 BC044216 NM_004873  
HGE095173 M01C037P13 pDONR221 MGC08-C07 BC044216 NM_004873  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR432697 RBdS081M09 pGCAP10 NM_001015048.1  
GGCGATGGCGCGgGCGGGACAGTGCTTGTGAAACTGAACACAACAAAAGTATGGATATGG
HKR475108 RBdS187M20 pGCAP10 NM_001015048.1  
GAGACTCTGTAGATACTGAAGGAAAAGGAGATATTCAGCAAGCTAGGAAGCGGGCAGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl