Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09059

HP ID(1) HP09059
Gene ID(2) 8725
Gene Symbol finder C19orf2
Protein Name chromosome 19 open reading frame 2
RefSeq NM_003796.2
Length of RefSeq (bp) 2295
Chromosome 19q12
Reference DDBJ accession
UniGene Hs.466391

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS081G19 pGCAP10 GACTTTTATTTTTCAACTTCCACTGATCTTTTAAAATTGAGGCAATATGCAGTAAAATAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl