Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081G19

Clone ID RBdS081G19
HP ID HP09059
Gene ID 8725
Gene Symbol C19orf2
Protein Name chromosome 19 open reading frame 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003796.2
Length of RefSeq (bp) 2295
Chromosome 19q12
Reference DDBJ accession
UniGene Hs.466391
5'-terminal sequence GACTTTTATTTTTCAACTTCCACTGATCTTTTAAAATTGAGGCAATATGCAGTAAAATAT
2011.08.28