Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09044

HP ID(1) HP09044
Gene ID(2) 91754
Gene Symbol finder NEK9
Protein Name NIMA (never in mitosis gene a)- related kinase 9
RefSeq NM_033116.4
Length of RefSeq (bp) 5560
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.719118

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075M01 pGCAP10 CGGCCGGCCGATGGCGGGGTTGCTGGGCTGACGGATCCGCGGGCCGGCATCTGAAGCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl