Prev. |  KEGG KO K20878 > 

RIKEN DNA Bank Human Resource - NEK9

Gene ID NCBI Gene 91754 |  KEGG hsa:91754
Gene Symbol NEK9
Protein Name NIMA related kinase 9
Synonyms APUG|LCCS10|NC|NERCC|NERCC1
Ortholog resource in our bank

  NEK9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082429 IRAL006B05 pOTB7 BC001714 NM_033116 Partial/var
HGY090598 IRAL026I06 pOTB7 BC009336 NM_033116 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR430289 RBdS075M01 pGCAP10 NM_033116.4  
CGGCCGGCCGATGGCGGGGTTGCTGGGCTGACGGATCCGCGGGCCGGCATCTGAAGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl