Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09036

HP ID(1) HP09036
Gene ID(2) 115209
Gene Symbol finder OMA1
Protein Name OMA1 homolog, zinc metallopeptidase (S. cerevisiae)
RefSeq NM_145243.3
Length of RefSeq (bp) 1928
Chromosome 1p32.1
Reference DDBJ accession
UniGene Hs.425769

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075H16 pGCAP10 GAGGTCGGGTCTGCGGTGTCACCGCTTTCGCTTCTGCTTGAGTAATCAAGTGAAAAAATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl