Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075H16

Clone ID RBdS075H16
HP ID HP09036
Gene ID 115209
Gene Symbol OMA1
Protein Name OMA1 homolog, zinc metallopeptidase (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_145243.3
Length of RefSeq (bp) 1928
Chromosome 1p32.1
Reference DDBJ accession
UniGene Hs.425769
5'-terminal sequence GAGGTCGGGTCTGCGGTGTCACCGCTTTCGCTTCTGCTTGAGTAATCAAGTGAAAAAATG
2011.08.28