Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09018

HP ID(1) HP09018
Gene ID(2) 6242
Gene Symbol finder RTKN
Protein Name rhotekin
RefSeq NM_001015055.1
Length of RefSeq (bp) 2208
Chromosome 2p13.1
Reference DDBJ accession
UniGene Hs.192854

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075A18 pGCAP10 GGCCGCAGGGCCTGGCGGCCGCCGAGTGAAGTGTGACTCCGTGGGCCTGGCGTGGAGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl