Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09014

HP ID(1) HP09014
Gene ID(2) 56897
Gene Symbol finder WRNIP1
Protein Name Werner helicase interacting protein 1
RefSeq NM_020135.2
Length of RefSeq (bp) 2670
Chromosome 6p25.2
Reference DDBJ accession
UniGene Hs.236828

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS070N08 pGCAP10 GGAGCGAGCGTCCTGCTGGTTCCCCGAGCGAGGGTCTCGCGGCGCGGGGCCTAGCGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl