Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070N08

Clone ID RBdS070N08
HP ID HP09014
Gene ID 56897
Gene Symbol WRNIP1
Protein Name Werner helicase interacting protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_020135.2
Length of RefSeq (bp) 2670
Chromosome 6p25.2
Reference DDBJ accession
UniGene Hs.236828
5'-terminal sequence GGAGCGAGCGTCCTGCTGGTTCCCCGAGCGAGGGTCTCGCGGCGCGGGGCCTAGCGGAGG
2011.08.28