Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08996

HP ID(1) HP08996
Gene ID(2) 25806
Gene Symbol finder VAX2
Protein Name ventral anterior homeobox 2
RefSeq NM_012476.2
Length of RefSeq (bp) 1163
Chromosome 2p13.3
Reference DDBJ accession
UniGene Hs.249170

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS070B24 pGCAP10 GAGGCTGGCTCCGCCGTAGAGGGGTTGGCAGTGGCGGTCAGCATGGGCGATGGGGGCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl