Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08992

HP ID(1) HP08992
Gene ID(2) 9213
Gene Symbol finder XPR1
Protein Name xenotropic and polytropic retrovirus receptor
RefSeq NM_004736.3
Length of RefSeq (bp) 8500
Chromosome 1q25.1
Reference DDBJ accession
UniGene Hs.227656

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051N20 pGCAP10 GGTAGCTGCTGGACCCGAGTGGGAGTGAGGGGGAAACGGCAGGATGAAGTTCGCCGAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl