Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08982

HP ID(1) HP08982
Gene ID(2) 11163
Gene Symbol finder NUDT4
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 4
RefSeq NM_019094.4
Length of RefSeq (bp) 4810
Chromosome 12q21
Reference DDBJ accession
UniGene Hs.506325

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051I18 pGCAP10 GGTCGCCGCGGTGCTGCTGCTCAGTGGGAGCGGGTCTTCGCAACTGTCTCCGCGTGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl