Prev. |  KEGG KO K07766 > 

RIKEN DNA Bank Human Resource - NUDT4

Gene ID NCBI Gene 11163 |  KEGG hsa:11163
Gene Symbol NUDT4
Protein Name nudix hydrolase 4
Synonyms DIPP-2B|DIPP2|DIPP2alpha|DIPP2beta|HDCMB47P|NUDT4B
Ortholog resource in our bank

  NUDT4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091916 IRAL029N04 pOTB7 BC012069 NM_199040 Full
HGY098912 IRAL047E16 pOTB7 BC051310 NM_199040 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420610 RBdS051I18 pGCAP10 NM_019094.4  
GGTCGCCGCGGTGCTGCTGCTCAGTGGGAGCGGGTCTTCGCAACTGTCTCCGCGTGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl