Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08968

HP ID(1) HP08968
Gene ID(2) 5126
Gene Symbol finder PCSK2
Protein Name proprotein convertase subtilisin/kexin type 2
RefSeq NM_002594.2
Length of RefSeq (bp) 4745
Chromosome 20p11.2
Reference DDBJ accession
UniGene Hs.315186

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS040O07 pGCAP10 GCTTTTCTCTCCGGTACACACAGCTCCCCACATTCGCACCCCTGCCCGCGCGCCGGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl