Prev. |  KEGG KO K01360 > 

RIKEN DNA Bank Human Resource - PCSK2

Gene ID NCBI Gene 5126 |  KEGG hsa:5126
Gene Symbol PCSK2
Protein Name proprotein convertase subtilisin/kexin type 2
Synonyms NEC 2|NEC-2|NEC2|PC2|SPC2
Ortholog resources KEGG ortholog (KEGG orthology K01360) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05885 pKM2L-phPC2 Promoter Bank clone, Human proprotein convertase 2 (PC2) promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025454 IRAK063K14 pBluescriptR BC040546 NM_002594 Partial/var
HGY085880 IRAL014L16 pOTB7 BC005815 NM_002594 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR416343 RBdS040O07 pGCAP10 NM_002594.2  
GCTTTTCTCTCCGGTACACACAGCTCCCCACATTCGCACCCCTGCCCGCGCGCCGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl