Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08945

HP ID(1) HP08945
Gene ID(2) 219988
Gene Symbol finder PATL1
Protein Name protein associated with topoisomerase II homolog 1 (yeast)
RefSeq NM_152716.2
Length of RefSeq (bp) 4142
Chromosome 11q12.1
Reference DDBJ accession
UniGene Hs.591960

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022P09 pGCAP10 GGCGAGCCGGTGGAGGACCCGCGCGCGGAGGAGCCGGGGAGTCAGCGCTTCTTCCCTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl