Prev. |  KEGG KO K12617 > 

RIKEN DNA Bank Human Resource - PATL1

Gene ID NCBI Gene 219988 |  KEGG hsa:219988
Gene Symbol PATL1
Protein Name PAT1 homolog 1, processing body mRNA decay factor
Synonyms Pat1b|hPat1b
Ortholog resources KEGG ortholog (KEGG orthology K12617) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037226 IRAK093B02 pCMV-SPORT6 BC048309 NM_152716 Partial
HGX056269 IRAK140L05 pCMV-SPORT6 BC065264 NM_152716 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR409169 RBdS022P09 pGCAP10 NM_152716.2  
GGCGAGCCGGTGGAGGACCCGCGCGCGGAGGAGCCGGGGAGTCAGCGCTTCTTCCCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl