Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08938

HP ID(1) HP08938
Gene ID(2) 4684
Gene Symbol finder NCAM1
Protein Name neural cell adhesion molecule 1
RefSeq NM_000615.5
Length of RefSeq (bp) 5951
Chromosome 11q23.1
Reference DDBJ accession
UniGene Hs.503878

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022M08 pGCAP10 GGAGTTGCGAGTGTGCTGAGGCTGGGACTGTCACTCATTCTCCGATCAGCGCGTGAACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl