Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08936

HP ID(1) HP08936
Gene ID(2) 51317
Gene Symbol finder PHF21A
Protein Name PHD finger protein 21A
RefSeq NM_016621.3
Length of RefSeq (bp) 7194
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.502458

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022L11 pGCAP10 GCAGAGAGAGAGAGAGAGAGAGAGAGAGAGTGAGTGAGAGAGAGAGGAGAGGAGAGGANC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl