Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022L11

Clone ID RBdS022L11
HP ID HP08936
Gene ID 51317
Gene Symbol PHF21A
Protein Name PHD finger protein 21A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016621.3
Length of RefSeq (bp) 7194
Chromosome 11p11.2
Reference DDBJ accession
UniGene Hs.502458
5'-terminal sequence GCAGAGAGAGAGAGAGAGAGAGAGAGAGAGTGAGTGAGAGAGAGAGGAGAGGAGAGGANC
2011.08.28