Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08917

HP ID(1) HP08917
Gene ID(2) 51230
Gene Symbol finder PHF20
Protein Name PHD finger protein 20
RefSeq NM_016436.4
Length of RefSeq (bp) 5899
Chromosome 20q11.22-q11.23
Reference DDBJ accession
UniGene Hs.517044

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022C20 pGCAP10 GAGAGTCCTTCTGTCGGTTGGTCCTGGAGCGGCGCAGCCGGAGTGGGGCCGTGAGATCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl