Prev. |  KEGG KO K18402 > 

RIKEN DNA Bank Human Resource - PHF20

Gene ID NCBI Gene 51230 |  KEGG hsa:51230
Gene Symbol PHF20
Protein Name PHD finger protein 20
Synonyms C20orf104|GLEA2|HCA58|NZF|TDRD20A|TZP
Ortholog resources KEGG ortholog (KEGG orthology K18402) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097914 IRAL044N02 pOTB7 BC048210 NM_016436 Partial
HGY087501 IRAL018M13 pOTB7 BC006415 NM_016436 Partial/var
HGY103702 IRAL059E06 pOTB7 BC080598 NM_016436 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR408868 RBdS022C20 pGCAP10 NM_016436.4  
GAGAGTCCTTCTGTCGGTTGGTCCTGGAGCGGCGCAGCCGGAGTGGGGCCGTGAGATCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl