Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08876

HP ID(1) HP08876
Gene ID(2) 54964
Gene Symbol finder C1orf56
Protein Name chromosome 1 open reading frame 56
RefSeq NM_017860.3
Length of RefSeq (bp) 2055
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.549171

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS014I13 pGCAP10 GTCAAACGACCCGGTGGGTCTACAGCGGAAGGGAGGGAGCGAAGGTAGGAGGCAGGGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl