Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014I13

Clone ID RBdS014I13
HP ID HP08876
Gene ID 54964
Gene Symbol C1orf56
Protein Name chromosome 1 open reading frame 56
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017860.3
Length of RefSeq (bp) 2055
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.549171
5'-terminal sequence GTCAAACGACCCGGTGGGTCTACAGCGGAAGGGAGGGAGCGAAGGTAGGAGGCAGGGCTT
2011.08.28