Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08873

HP ID(1) HP08873
Gene ID(2) 25950
Gene Symbol finder RWDD3
Protein Name RWD domain containing 3
RefSeq NM_015485.4
Length of RefSeq (bp) 1250
Chromosome 1p21.3
Reference DDBJ accession
UniGene Hs.709591

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS014G07 pGCAP10 GGGGGCCCACAGCCATGGCGGAGCCTGTGCAGGAGGAGCTCTCGGTCCTGGCCGCGATTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl