Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08851

HP ID(1) HP08851
Gene ID(2) 7186
Gene Symbol finder TRAF2
Protein Name TNF receptor-associated factor 2
RefSeq NM_021138.3
Length of RefSeq (bp) 2298
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.522506

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS013I13 pGCAP10 GAGTTCCGGGCGCGCTGCNACCGTTGGGGCTTTGTTCGCGGGGGNNTANNNTTAATNNAN
RBdS110K21 pGCAP10 GAGTTCCGGGCGCGCTGCGACCGTTGGGGCTTTGTTCGCGGGGGTCACANNTCTAANGNC
RBdS132L15 pGCAP10 GGGGCGCGCTGCGACCGTTGGGGCTTTGTTCGCGGGGGTCACAGCTCTCATGGCTGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl