DNA Bank Top |  KEGG KO K03173 > 

RIKEN DNA Bank Human Resource - TRAF2

Gene ID NCBI Gene 7186 |  KEGG hsa:7186
Gene Symbol TRAF2
Protein Name TNF receptor associated factor 2
Synonyms MGC:45012|RNF117|TRAP|TRAP3
Featured content Sphingolipid signaling pathway (human)
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  TRAF2


External database

human TRAF2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB16744 pcDNA3-FLAG-human TRAF2 Expression vector of human TNF receptor associated factor 2 (TRAF2) tagged with FLAG.    
RDB05412 pAxCALNLhTRAF2 (reverse) Shuttle vector to generate rAd harboring human TRAF2 (reverse)    
RDB05411 pAxCALNLhTRAF2 (forward) Shuttle vector to generate rAd harboring human TRAF2 (forward)    
RDB04745 pAxCALNLhTRAF2(reverse) Shuttle vector to generate rAd expressing human TRAF2    
RDB04719 pAxCALNLhTRAF2(forward) Shuttle vector to generate rAd expressing human TRAF2    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025871 IRAK064L07 pCMV-SPORT6 BC032410 NM_021138 Full
HGX027483 IRAK068L19 pCMV-SPORT6 BC033810 NM_021138 Full
HGX035836 IRAK089J20 pCMV-SPORT6 BC043492 NM_021138 Full
HGX044362 IRAK110P02 pCMV-SPORT6 BC064662 NM_021138 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007529 W01A018N17 pENTR-TOPO IRAK064L07 BC032410 NM_021138  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405405 RBdS013I13 pGCAP10 NM_021138.3  
GAGTTCCGGGCGCGCTGCNACCGTTGGGGCTTTGTTCGCGGGGGNNTANNNTTAATNNAN
HKR444261 RBdS110K21 pGCAP10 NM_021138.3  
GAGTTCCGGGCGCGCTGCGACCGTTGGGGCTTTGTTCGCGGGGGTCACANNTCTAANGNC
HKR453079 RBdS132L15 pGCAP10 NM_021138.3  
GGGGCGCGCTGCGACCGTTGGGGCTTTGTTCGCGGGGGTCACAGCTCTCATGGCTGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl