Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08834

HP ID(1) HP08834
Gene ID(2) 54627
Gene Symbol finder KIAA1383
Protein Name KIAA1383
RefSeq NM_019090.2
Length of RefSeq (bp) 5455
Chromosome 1q42.2
Reference DDBJ accession
UniGene Hs.160373

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007M03 pGCAP10 AGCTCTTCCGCCTGCAGCCTGCTACCCTGCACTGCCGGCTCCTGCGGACCCCGCTTGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl