Prev. | 

RIKEN DNA Bank Human Resource - MAP10

Gene ID NCBI Gene 54627 |  KEGG hsa:54627
Gene Symbol MAP10
Protein Name microtubule associated protein 10
Synonyms KIAA1383|MTR120
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR403091 RBdS007M03 pGCAP10 NM_019090.3 Partial done
AGCTCTTCCGCCTGCAGCCTGCTACCCTGCACTGCCGGCTCCTGCGGACCCCGCTTGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl