Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08823

HP ID(1) HP08823
Gene ID(2) 7481
Gene Symbol finder WNT11
Protein Name wingless-type MMTV integration site family, member 11
RefSeq NM_004626.2
Length of RefSeq (bp) 1927
Chromosome 11q13.5
Reference DDBJ accession
UniGene Hs.108219

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007H02 pGCAP10 GGCAGGCGGCGTGCAGGACCAGCGGCGGCCGTGCAGGCGGAGGACTTCGGCGCGGCTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl